www.sib.swiss
Open in
urlscan Pro
192.42.198.53
Public Scan
Submitted URL: https://sib-swiss.ch/
Effective URL: https://www.sib.swiss/
Submission: On April 03 via api from CH — Scanned from CH
Effective URL: https://www.sib.swiss/
Submission: On April 03 via api from CH — Scanned from CH
Form analysis
1 forms found in the DOMPOST /
<form class="sib-newsletter-subscriber-form" data-drupal-selector="sib-newsletter-subscriber-form" action="/" method="post" id="sib-newsletter-subscriber-form" accept-charset="UTF-8">
<div class="field--type-email field--name-email field--widget-email-default js-form-wrapper form-wrapper" data-drupal-selector="edit-email-wrapper" id="edit-email-wrapper">
<div class="js-form-item form-item js-form-type-email form-item-email-0-value js-form-item-email-0-value">
<label for="edit-email-0-value" class="js-form-required form-required">Email</label>
<input data-drupal-selector="edit-email-0-value" type="email" id="edit-email-0-value" name="email[0][value]" value="" size="60" maxlength="254" placeholder="" class="form-email required" required="required" aria-required="true">
</div>
</div>
<input data-drupal-selector="edit-honeypot-time" type="hidden" name="honeypot_time" value="G1wFbyfSFSxlaokFec9RVZa0P4N7e-jLjhg16FrmD7A">
<input autocomplete="off" data-drupal-selector="form-pg1pnmqm-1nhg2w9nmxekb9ut0jvoyt1oz2hqujdnqu" type="hidden" name="form_build_id" value="form-pg1PnMqM-1nhg2w9NMXeKB9uT0jVOyt1Oz2HQuJDNqU">
<input data-drupal-selector="edit-sib-newsletter-subscriber-form" type="hidden" name="form_id" value="sib_newsletter_subscriber_form">
<div class="field--type-entity-reference field--name-field-classification field--widget-options-select js-form-wrapper form-wrapper" data-drupal-selector="edit-field-classification-wrapper" id="edit-field-classification-wrapper">
<div class="js-form-item form-item js-form-type-select form-item-field-classification js-form-item-field-classification">
<label for="edit-field-classification" class="js-form-required form-required">Help us improve the content you receive by telling us who you are</label>
<select data-drupal-selector="edit-field-classification" id="edit-field-classification" name="field_classification" class="form-select required" required="required" aria-required="true">
<option value="_none">- Select -</option>
<option value="316">A scientist from the private sector</option>
<option value="339">A scientist from the academia/public sector</option>
<option value="340">A health professional</option>
<option value="341">A journalist or science communicator</option>
<option value="342">Other</option>
</select>
</div>
</div>
<fieldset class="mailing-lists-fieldset js-form-item form-item js-form-wrapper form-wrapper" data-drupal-selector="edit-mailing-lists" id="edit-mailing-lists">
<legend>
<span class="fieldset-legend">Register me to</span>
</legend>
<div class="fieldset-wrapper">
<div class="js-form-item form-item js-form-type-checkbox form-item-mailing-lists-swiss-bioinformatics-newsletter js-form-item-mailing-lists-swiss-bioinformatics-newsletter">
<input data-drupal-selector="edit-mailing-lists-swiss-bioinformatics-newsletter" aria-describedby="edit-mailing-lists-swiss-bioinformatics-newsletter--description" type="checkbox" id="edit-mailing-lists-swiss-bioinformatics-newsletter"
name="mailing_lists[swiss_bioinformatics_newsletter]" value="1" checked="checked" class="form-checkbox">
<label for="edit-mailing-lists-swiss-bioinformatics-newsletter" class="option">Swiss bioinformatics newsletter</label>
<button type="button" aria-label="More information: Discoveries and projects, institutional news, popular training courses and activities, 4 editions per year" x-init="tippy($el, {
content:'Discoveries\u0020and\u0020projects,\u0020institutional\u0020news,\u0020popular\u0020training\u0020courses\u0020and\u0020activities,\u00204\u0020editions\u0020per\u0020year',
theme: 'sib-green',
placement: 'right',
animation: 'shift-away-subtle',
});">
<svg class="fill-current w-4 h-4 text-custom_cyan_web" viewBox="0 0 3.175 3.175" xmlns="http://www.w3.org/2000/svg">
<path
d="M1.588 0A1.587 1.587 0 0 0 0 1.587a1.587 1.587 0 0 0 1.588 1.588 1.587 1.587 0 0 0 1.587-1.588A1.587 1.587 0 0 0 1.588 0zm.048.728c.056 0 .104.018.144.055.04.038.06.082.06.134 0 .052-.02.096-.06.134a.203.203 0 0 1-.144.055.205.205 0 0 1-.145-.055.175.175 0 0 1-.06-.134c0-.052.02-.096.06-.134a.205.205 0 0 1 .145-.055zm-.208.499h.415V2.38h-.415V1.227z">
</path>
</svg>
</button>
</div>
<div class="js-form-item form-item js-form-type-checkbox form-item-mailing-lists-sib-profile-annual-activity-repo js-form-item-mailing-lists-sib-profile-annual-activity-repo">
<input data-drupal-selector="edit-mailing-lists-sib-profile-annual-activity-repo" aria-describedby="edit-mailing-lists-sib-profile-annual-activity-repo--description" type="checkbox" id="edit-mailing-lists-sib-profile-annual-activity-repo"
name="mailing_lists[sib_profile_annual_activity_repo]" value="1" class="form-checkbox">
<label for="edit-mailing-lists-sib-profile-annual-activity-repo" class="option">SIB Profile</label>
<button type="button" aria-label="More information: Activity report including a focus on two topical scientific subjects, 1 edition per year" x-init="tippy($el, {
content:'Activity\u0020report\u0020including\u0020a\u0020focus\u0020on\u0020two\u0020topical\u0020scientific\u0020subjects,\u00201\u0020edition\u0020per\u0020year',
theme: 'sib-green',
placement: 'right',
animation: 'shift-away-subtle',
});">
<svg class="fill-current w-4 h-4 text-custom_cyan_web" viewBox="0 0 3.175 3.175" xmlns="http://www.w3.org/2000/svg">
<path
d="M1.588 0A1.587 1.587 0 0 0 0 1.587a1.587 1.587 0 0 0 1.588 1.588 1.587 1.587 0 0 0 1.587-1.588A1.587 1.587 0 0 0 1.588 0zm.048.728c.056 0 .104.018.144.055.04.038.06.082.06.134 0 .052-.02.096-.06.134a.203.203 0 0 1-.144.055.205.205 0 0 1-.145-.055.175.175 0 0 1-.06-.134c0-.052.02-.096.06-.134a.205.205 0 0 1 .145-.055zm-.208.499h.415V2.38h-.415V1.227z">
</path>
</svg>
</button>
</div>
<div class="js-form-item form-item js-form-type-checkbox form-item-mailing-lists-in-silico-talks js-form-item-mailing-lists-in-silico-talks">
<input data-drupal-selector="edit-mailing-lists-in-silico-talks" aria-describedby="edit-mailing-lists-in-silico-talks--description" type="checkbox" id="edit-mailing-lists-in-silico-talks" name="mailing_lists[in_silico_talks]" value="1"
class="form-checkbox">
<label for="edit-mailing-lists-in-silico-talks" class="option"><em>in silico</em> talks</label>
<button type="button" aria-label="More information: Short technical talks about new methods, research or resources, 1 edition per month" x-init="tippy($el, {
content:'Short\u0020technical\u0020talks\u0020about\u0020new\u0020methods,\u0020research\u0020or\u0020resources,\u00201\u0020edition\u0020per\u0020month',
theme: 'sib-green',
placement: 'right',
animation: 'shift-away-subtle',
});">
<svg class="fill-current w-4 h-4 text-custom_cyan_web" viewBox="0 0 3.175 3.175" xmlns="http://www.w3.org/2000/svg">
<path
d="M1.588 0A1.587 1.587 0 0 0 0 1.587a1.587 1.587 0 0 0 1.588 1.588 1.587 1.587 0 0 0 1.587-1.588A1.587 1.587 0 0 0 1.588 0zm.048.728c.056 0 .104.018.144.055.04.038.06.082.06.134 0 .052-.02.096-.06.134a.203.203 0 0 1-.144.055.205.205 0 0 1-.145-.055.175.175 0 0 1-.06-.134c0-.052.02-.096.06-.134a.205.205 0 0 1 .145-.055zm-.208.499h.415V2.38h-.415V1.227z">
</path>
</svg>
</button>
</div>
<div class="js-form-item form-item js-form-type-checkbox form-item-mailing-lists-bioinformatics-awards js-form-item-mailing-lists-bioinformatics-awards">
<input data-drupal-selector="edit-mailing-lists-bioinformatics-awards" aria-describedby="edit-mailing-lists-bioinformatics-awards--description" type="checkbox" id="edit-mailing-lists-bioinformatics-awards"
name="mailing_lists[bioinformatics_awards]" value="1" class="form-checkbox">
<label for="edit-mailing-lists-bioinformatics-awards" class="option">Bioinformatics awards</label>
<button type="button" aria-label="More information: All about the biyearly SIB Awards competition – deadlines, criteria, etc." x-init="tippy($el, {
content:'All\u0020about\u0020the\u0020biyearly\u0020SIB\u0020Awards\u0020competition\u0020\u2013\u0020deadlines,\u0020criteria,\u0020etc.',
theme: 'sib-green',
placement: 'right',
animation: 'shift-away-subtle',
});">
<svg class="fill-current w-4 h-4 text-custom_cyan_web" viewBox="0 0 3.175 3.175" xmlns="http://www.w3.org/2000/svg">
<path
d="M1.588 0A1.587 1.587 0 0 0 0 1.587a1.587 1.587 0 0 0 1.588 1.588 1.587 1.587 0 0 0 1.587-1.588A1.587 1.587 0 0 0 1.588 0zm.048.728c.056 0 .104.018.144.055.04.038.06.082.06.134 0 .052-.02.096-.06.134a.203.203 0 0 1-.144.055.205.205 0 0 1-.145-.055.175.175 0 0 1-.06-.134c0-.052.02-.096.06-.134a.205.205 0 0 1 .145-.055zm-.208.499h.415V2.38h-.415V1.227z">
</path>
</svg>
</button>
</div>
<div class="js-form-item form-item js-form-type-checkbox form-item-mailing-lists--bc-2 js-form-item-mailing-lists--bc-2">
<input data-drupal-selector="edit-mailing-lists-bc-2" aria-describedby="edit-mailing-lists-bc-2--description" type="checkbox" id="edit-mailing-lists-bc-2" name="mailing_lists[_bc_2]" value="1" class="form-checkbox">
<label for="edit-mailing-lists-bc-2" class="option">[BC]<sup>2 </sup>Basel Computational Biology Conference</label>
<button type="button" aria-label="More information: All about the biyearly Basel Computational Biology Conference – calls, programme, deadlines, etc." x-init="tippy($el, {
content:'All\u0020about\u0020the\u0020biyearly\u0020Basel\u0020Computational\u0020Biology\u0020Conference\u0020\u2013\u0020calls,\u0020programme,\u0020deadlines,\u0020etc.',
theme: 'sib-green',
placement: 'right',
animation: 'shift-away-subtle',
});">
<svg class="fill-current w-4 h-4 text-custom_cyan_web" viewBox="0 0 3.175 3.175" xmlns="http://www.w3.org/2000/svg">
<path
d="M1.588 0A1.587 1.587 0 0 0 0 1.587a1.587 1.587 0 0 0 1.588 1.588 1.587 1.587 0 0 0 1.587-1.588A1.587 1.587 0 0 0 1.588 0zm.048.728c.056 0 .104.018.144.055.04.038.06.082.06.134 0 .052-.02.096-.06.134a.203.203 0 0 1-.144.055.205.205 0 0 1-.145-.055.175.175 0 0 1-.06-.134c0-.052.02-.096.06-.134a.205.205 0 0 1 .145-.055zm-.208.499h.415V2.38h-.415V1.227z">
</path>
</svg>
</button>
</div>
</div>
</fieldset>
<div data-drupal-selector="edit-actions" class="form-actions js-form-wrapper form-wrapper" id="edit-actions"><button data-drupal-selector="edit-submit" type="submit" id="edit-submit" name="op" value="Sign up"
class="button button--primary js-form-submit form-submit button--with-icon" data-once="drupal-ajax">
<span class="button--text">Sign up</span>
<span class="button--icon"><svg class="fill-current icon" viewBox="0 0 512 512" fill="currentColor" xmlns="http://www.w3.org/2000/svg">
<path
d="M71.505 88.49c-31.76 0-57.623 25.998-57.623 58.026 0 32.095 25.83 58.059 57.623 58.059h19.197c18.392 0 33.3 14.975 33.3 33.501v35.881c0 18.493-14.908 33.502-33.3 33.502H71.539c-31.86-.034-57.657 25.93-57.657 57.992 0 32.06 25.83 58.058 57.623 58.058 31.86 0 57.657-25.997 57.657-58.025v-17.756c0-18.493 14.875-33.502 33.267-33.502h19.163c31.827 0 57.624-25.964 57.624-58.025v-.402c0-32.061-25.797-58.025-57.624-58.025H162.43a33.368 33.368 0 0 1-33.267-33.502v-17.756c0-32.028-25.797-58.025-57.623-58.025zm258.87 0c-31.828 0-57.624 25.998-57.624 58.026 0 32.095 25.796 58.059 57.623 58.059h19.23c18.393 0 33.268 14.975 33.268 33.501v35.881c0 18.493-14.875 33.502-33.268 33.502h-19.23c-31.827 0-57.623 25.93-57.623 58.025 0 32.028 25.796 58.025 57.623 58.025 31.86 0 57.657-25.997 57.657-58.025v-17.756c0-18.493 14.875-33.502 33.234-33.502h19.23c31.827 0 57.623-25.964 57.623-58.025v-.402c0-32.061-25.796-58.025-57.623-58.025h-19.23a33.368 33.368 0 0 1-33.234-33.502v-17.756c0-32.028-25.797-58.025-57.623-58.025z"
style="stroke-width:33.5019"></path>
</svg></span>
</button>
</div>
<div class="url-textfield js-form-wrapper form-wrapper" style="display: none !important;">
<div class="js-form-item form-item js-form-type-textfield form-item-url js-form-item-url">
<label for="edit-url">Leave this field blank</label>
<input autocomplete="off" data-drupal-selector="edit-url" type="text" id="edit-url" name="url" value="" size="20" maxlength="128" class="form-text">
</div>
</div>
<div id="sib-newsletter-subscribe-response"></div>
</form>
Text Content
Skip to main content * Services Close menu Open software and databases Discover our world-class, open biodata resources. Coordination Find out how we bring together key partners and data in large-scale projects. Centre of excellence The comprehensive bioinformatics services we offer to unleash innovation in the life sciences. SVG Biostatistics and bioinformatics analysis SVG Data stewardship and management SVG Knowledge representation SVG Sensitive data sharing SVG Software development SVG Training Let's collaborate What life science data challenges can we help you solve? Contact us * Training Close menu Upcoming courses 09 Apr 2024 Best Practices in High-Perfomance Computing (sciCORE cluster) Streamed 15 - 17 Apr 2024 NGS - Quality Control, Alignment, Visualisation Streamed Bern Scientific training Acquire skills to make the most out of the latest advances in bioinformatics and data science. Upcoming training courses E-learning Course materials Who do we train PhD Training Network Stay tuned Be the first to receive announcements of new courses. Leave us your email * Community Close menu Network We promote bioinformatics through our network across Switzerland, fostering a strong community spirit to enable innovation and collaboration. * How to join * Focus groups and other initiatives Publications Peer-reviewed articles and preprints by our scientists. Our groups Find out more about our experts both at the SIB Hub and institutions across Switzerland. Browse our groups Find people Our support functions Awards Bioinformatics Awards Remarkable Outputs * What's on Close menu Latest outputs The latest scientific developments, projects and news from our scientists. Discover the in silico talks, a series of webinars by our scientists. Browse our in silico talks Stay informed Receive the latest updates Current focus areas The cutting-edge topics we are pioneering for a better future Artificial intelligence and machine learning Biodiversity Open research data Personalized health Our conferences 24-26 June 2024 08-11 September 2025 Upcoming events * About Close menu Flagship projects National platforms and secure IT networks, diagnostic tools, international projects and more. BioMedIT The national secure IT network for health-related data. Swiss Pathogen Surveillance Platform Advancing pathogen monitoring. About Find out what drives us, our mission, identity and history over the years. Who we are Our impact Activities for the public Our organization Governance SIB Hub Funding sources Our engagements Working at SIB Environmental impact Equality, Diversity, Inclusion Browse the SIB Profile, our activity report Discover our yearly highlights and dive into focus chapters on selected themes. SIB Profile Previous editions * Intranet * Careers * Contact Search Menu Close WE TURN LIFE SCIENCE DATA INTO SOLUTIONS Are you a life scientist, a clinician, a biotech or biomedical start-up, SME or pharma? You are at the right place: the SIB Swiss Institute of Bioinformatics is an internationally recognized non-profit organization dedicated to biological and biomedical data science. Our impact Our services Our data resources ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG LATEST NEWS AND SCIENTIFIC TALKS See all news In silico talk EASY SIMULATION OF SPECIES TREES AND POPULATIONS OVER TIME USING REMASTER 02 April 2024 Virtually observing how species evolve and populations change through generations is the purpose of phylodynamics simulations. Such simulations are at the core of understanding how disease spread or species persist in a fragmented habitat... Read more News THREE SIB GROUP LEADERS JOIN ISCB’S 2024 CLASS OF FELLOWS 14 March 2024 SIB’s Niko Beerenwinkel (Computational Biology group), Torsten Schwede (Computational Structural Biology group) and Mihaela Zavolan (RNA Regulatory Networks group) are elected as 2024 Fellows by the International Society for Computational... Read more In silico talk HOW TO BOOST YOUR RESEARCH WITH SIB’S SEMANTIC WEB OF DATA 08 March 2024 Answering complex biological questions often involves separately querying several biodata resources, and combining the resulting data. In this talk, Tarcisio Mendes de Farias, Knowledge Representation Manager, introduces SIB’s Semantic Web... Read more News EUROPEAN RECOGNITION FOR SWISS-MODEL AND MODELARCHIVE: AN INTERVIEW 13 February 2024 Several additional data resources developed at SIB have recently been recognized as crucial to the international life science community. On the European level, SWISS-MODEL and ModelArchive have been selected as ELIXIR Core Data Resource and... Read more In silico talk Easy simulation of species trees and populations over time using ReMASTER News Three SIB Group Leaders join ISCB’s 2024 Class of Fellows In silico talk How to boost your research with SIB’s Semantic Web of data News European recognition for SWISS-MODEL and ModelArchive: an interview See all news THE SIB PROFILE 2023, OUR LATEST ACTIVITY REPORT! Find out more about our work over 25 years as data scientists for life. Discover HELP US TO ASSESS THE USE AND VALUE OF UNIPROT Together with EMBL-EBI, we are conducting a survey on the costs and benefits of using UniProt when building innovative solutions. Fill out the survey WHAT WE BRING TO THE WORLD OF SCIENCE From national coordination projects to data services and resources. RESOURCES We enable life science research through the provision of world-leading open science databases and software. Access our resources CENTRE OF EXCELLENCE We leverage our expertise and non-profit status for the benefit of academia, hospitals or the industry, in Switzerland and abroad. Browse our services COORDINATION We break down silos to bring together data and experts over multicentric projects, and maximise investments. Learn more CREATING POSITIVE IMPACT FOR SCIENCE AND SOCIETY Our data scientists serve biology, health, environment: find out about our flagship projects and commitments. Flagship project CONNECTING RESEARCHERS TO HEALTH DATA BioMedIT: the national secure IT network for the responsible processing of health-related data. Discover Current focus areas BIODIVERSITY What can genes and genome tell us about protecting species Discover Flagship project ADVANCING PATHOGEN MONITORING: THE SWISS PATHOGEN SURVEILLANCE PLATFORM (SPSP) The platform improves international coordination and research efficiency Discover Current focus areas ARTIFICIAL INTELLIGENCE AND MACHINE LEARNING Take stock of our experts’ advances in the field of artificial intelligence Discover OTHER FLAGSHIP PROJECTS Flagship project European public-private partnerships SIB acts as an expert in research data management internationally Flagship project Oncobench® Analyzing genomic data from cancer patients OTHER THEMES Current focus areas Open research data Concrete actions to accelerate discoveries and scientific research Current focus areas Personalized health Making sense of health data to guide treatment decisions Over the past 25 years, the institute has established itself as the Swiss reference for biological and biomedical data science. Simone de Montmollin National Councillor, President of the Science, Education and Culture Committee SECC Switzerland is well positioned, thanks to infrastructure like that of SIB. Felix Gutzwiller Former member of the Council of States and National Council At a time of revolutionary advances in biology and biomedicine, both in scientific research and its applications, with direct implications for society and the economy, the role of SIB is even more important and central than ever. Scientific Advisory Board SAB review, January 2022 WILLING TO CONTRIBUTE TO OUR NATIONAL NETWORK ? We are the largest national community of bioinformaticians in Europe With 200 employees and 700 members, SIB is bringing a wealth of expertise to researchers in the industry, the academia and the clinical realm. Job openings How to join Cutting-edge Sharing innovative practices and collaborating on common projects at the forefront of technology and science. -------------------------------------------------------------------------------- Impactful Our projects and resources tackle important societal challenges, from health to the environment. -------------------------------------------------------------------------------- Audible Our members benefit from unique collaboration and promotion initiatives nationally and internationally. WHAT IS BIOINFORMATICS ? Learn about bioinformatics Life scientists and clinicians have always tried to assemble data and evidence to find the right answers to fundamental questions. Nowadays, there is no shortage of data. But a different kind of problem has emerged. New technologies are producing data at an unprecedented speed. Indeed, so much data – and of such variety – that they can no longer be interpreted by the human mind alone. Discover our activities for the public Play Stay informed SIGN UP FOR OUR NEWSLETTERS FOR THE LATEST FROM BIOINFORMATICS MADE IN SWITZERLAND. Email Help us improve the content you receive by telling us who you are - Select -A scientist from the private sectorA scientist from the academia/public sectorA health professionalA journalist or science communicatorOther Register me to Swiss bioinformatics newsletter SIB Profile in silico talks Bioinformatics awards [BC]2 Basel Computational Biology Conference Sign up Leave this field blank We treat your personal data with care, view our privacy notice here. DATA SCIENTISTS FOR LIFE SIB Swiss Institute of Bioinformatics Quartier Sorge Bâtiment Amphipôle 1015 Lausanne / Switzerland Contact us * Services * Open software and databases * Centre of excellence * Coordination * contact * Training * Upcoming training courses * Community * Our groups * Network * Awards * How to join SIB * Publications * What's on * News * in silico talks * Conferences * Current focus areas * About * Who we are * Our impact * Flagship projects * Activities for the public * Governance and organization * Funding sources * Environmental impact * Equality, Diversity, Inclusion Follow us on social media SVG SVG SVG SVG SVG © 2023 - SIB Swiss Institute of Bioinformatics * Privacy policy Search * Services * Training * Community * What's on * About Back SERVICES Centre of excellence The comprehensive bioinformatics services we offer to unleash innovation in the life sciences. SVG Biostatistics and bioinformatics analysis SVG Data stewardship and management SVG Knowledge representation SVG Sensitive data sharing SVG Software development SVG Training Open software and databases Discover our world-class, open biodata resources. Coordination Find out how we bring together key partners and data in large-scale projects. Let's collaborate What life science data challenges can we help you solve? Contact us Back TRAINING Scientific training Acquire skills to make the most out of the latest advances in bioinformatics and data science. Upcoming training courses E-learning Course materials Who do we train PhD Training Network Upcoming courses 09 Apr 2024 Best Practices in High-Perfomance Computing (sciCORE cluster) Streamed 15 - 17 Apr 2024 NGS - Quality Control, Alignment, Visualisation Streamed Bern Stay tuned Be the first to receive announcements of new courses. Leave us your email Back COMMUNITY Our groups Find out more about our experts both at the SIB Hub and institutions across Switzerland. Browse our groups Find people Our support functions Network We promote bioinformatics through our network across Switzerland, fostering a strong community spirit to enable innovation and collaboration. * How to join * Focus groups and other initiatives Publications Peer-reviewed articles and preprints by our scientists. Awards Bioinformatics Awards Remarkable Outputs Back WHAT'S ON Current focus areas The cutting-edge topics we are pioneering for a better future Artificial intelligence and machine learning Biodiversity Open research data Personalized health Latest outputs The latest scientific developments, projects and news from our scientists. Discover the in silico talks, a series of webinars by our scientists. Browse our in silico talks Stay informed Receive the latest updates Our conferences 24-26 June 2024 08-11 September 2025 Upcoming events Back ABOUT About Find out what drives us, our mission, identity and history over the years. Who we are Our impact Activities for the public Our organization Governance SIB Hub Funding sources Our engagements Working at SIB Environmental impact Equality, Diversity, Inclusion Flagship projects National platforms and secure IT networks, diagnostic tools, international projects and more. BioMedIT The national secure IT network for health-related data. Swiss Pathogen Surveillance Platform Advancing pathogen monitoring. Browse the SIB Profile, our activity report Discover our yearly highlights and dive into focus chapters on selected themes. SIB Profile Previous editions * Intranet * Careers * Contact